Skip to content

xiaoli-dong/pcrValidator

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

48 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

pcrValidator

pcrValidator is a stand-alone and automated pipleine developed in Python3. It was designed to assess the DNA oligonucleotide sequences of primers and probes used in diagnostic qPCR or conventional PCR assays in ProvLab, Alberta. It firstly searches user supplied primer and probe sequences against the target DNA sequences, which can be genome or gene sequences, to identify the target regions of the DNA sequences using NCBI blastn or tntblast. Secondly, the identified target regions, amplicons, were then run through Mafft program to generate multiple sequence alignments. Based on the amplicon multiple sequence alignments, pcrValidator produces reports on assay performance and sequence variants in the primer and probe sites.

pcrValidator_workflow

Required third-party software

  • NCBI Blast: a suite of programs provided by NCBI for aligning query sequences against those present in a selected target database.
  • ThermonucleotideBLAST: a software program for searching a target database of nucleic acid sequences using an assay-specific query.
  • mafft: a multiple sequence alignment program

Installation

  • Firstly, you need to make sure that tntblast and mafft programs are installed and added into your PATH
  • Download pcrValidator program and move into the pcrValidator directory
  • Run the following commands to create a virtual environtment, activate the virtual environment, and install the dependency packages into the newly created virtual environment:
#create a virtual environment and activate it
python3 -m venv .venv

#activate the virtual environment
source .venv/bin/activate

# install required packages contained in requirement.product.txt, then you are ready to run the program
pip install -r requirements.product.txt

Now, you are ready to run the program

Prepare the reference database for searching

If you do not have reference sequences, you can use the script below to download your preferred sequences from NCBI. To use the script, user needs to provide a query string. The query string can be built by using ncbi's Nucleotide Advanced Search Builder

# check the script input options:
python bin/fetch_gbk.py -h

# example command to download the genbank format nucleotide sequences from NCBI
python bin/fetch_gbk.py -q "txid138948[Organism]" -d nucleotide -e test@example.com -p mpx -r gb 

Quick start

pcrValidator allows users to choose blastn or tnbblast to search PCR template sequences or primer and probe sequences against the user defined fasta format reference sequences to identity target amplicons. When the tntblast is chosen, the program only requires user to provide a assay.csv file, in which each line describes a PCR assays and define the location of the fasta format reference file. When the blastn is chosen, the program requires both the assay.csv file and a fasta format PCR template file, which contains one or multiple PCR template sequences. The assay.csv file has multiple lines and each line has eight columns (for taqman assay) or six columns (for conventional PCR assay) to describe the assay. assay.csv file is in the format of:

assay_name,forward_primer_name,forward_primer_seq,reverse_primer_name,reverse_primer_seq,probe_name,probe_seq 

See below for an example assay csv file

test1,mpx1.fasta,test1_Fwd,GGAAAATGTAAAGACAACGAATACAG,test1_Rev,GCTATCACATAATCTGGAAGCGTA,test1_Probe,AAGCCGTAATCTATGTTGTCTATCGTGTCC
test2,mpx2.fasta,test2_Fwd,CACACCGTCTCTTCCACAGA,test2_Rev,GATACAGGTTAATTTCCACATCG,test2_Probe,AACCCGTCGTAACCAGCAATACATTT

Notes:

  • all oligo sequences should be written in the 5' to 3' orientation
  • degenerate nucleotides are permitted in the assay oligo sequences
  • the probe name and probe sequence can be omitted for a conventional PCR

Run pcrValidator to generate primer, probe region mutation report

# check command line options
python bin/pcrValidator.py -h

#check command options when using blastn searching algorithm
python bin/pcrValidator.py blastn -h

# run the pcrValidator with blastn 
python bin/pcrValidator.py blastn --assay assay.csv --template template.fasta --outdir results --prefix mpx

#check command options when using tntblast searching algorithm
python bin/pcrValidator.py tntblast -h

# run the pcrValidator with tntblast 
python bin/pcrValidator.py tntblast --assay assay.csv --outdir results --prefix mpx

The pcrValidator program generates five reports for each assay:

  • pcr report (*_pcr.tsv)
  • assay report (*_assay_report.tsv)
  • forward primer variant report (*_fwd_variants.tsv)
  • reverse primer variant report (*_rev_variants.tsv)
  • proble variant report (*_proble_variants.tsv)

In addition, the program outputs also include the identified fasta format amplicon sequence file and its fasta format multiple sequence alignment file, which can be visualized by some other software such as JalView

The example outputs can be accessed from test directory

About

No description, website, or topics provided.

Resources

Stars

1 star

Watchers

1 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors