Skip to content

alejandrorgijon/plada_package

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

54 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Plada: an R package to PLAy with your DAta

The package plada aims to help you PLAying with your DAta (quite original name, huh?).

During my PhD I needed some specific functions in R, but I could not find a package that would perform them. Therefore, I decided to develope them. I used these functions to sort and analyze genomic information and metadata of microbial genomes assembled from metagenomes (MAGs), but I certainly think many people from other fields can find them useful!

At the moment, plada has 5 functions, but I may include more functions in the future: suggestions are appreciated. Note that the package also includes 4 tables with data (sequences, some_bacteria,environments and random_data) to test the functions included here. But I'm sorry to tell you my friend, these tables were randomly generated and they are not real.

Installation

This package is currently only available through GitHub and can be downloaded using devtools.

> install.packages("devtools")
> devtools::install_github("alejandrorgijon/plada")

Functions

gesize():

This function calculates the GC percentage of given sequences and calculates the length of them (aka number of bases). For example, I have provided in the package a fake dataset of genetic sequences called sequences:

> head(sequences)
1       seq1    GCGCGCGGGCATCGTAGCTGCTCGCGCTAGCTACGTCCGCTCTCGACTAGCTGACTGCGCTCAGCTATGCTACGATCGTACGATCGTGCTATGCTAGTGCATGCTAGCTAGC
2       seq2    CGATCGTAGCTACGTAGCTAGCTGATCGACTAGTGATCGCGTAGCTAGCTGCTGCTCGTCGTATGACTAGCTGATCGATCGATCGATCGTAGCTAGCTAGCTAGCTGATCGTAG
3       seq3    cgatcgcgatcgtactgctgtcggtggcta
4       seq4    cgatactcatatgcgtcgtaacgtctgctgtgtgtgctactatcgtagctacgtacgatcgatcgtgactcgatcgtagactg
5       seq5    ACTCGTAGCGTTGGTCATcatcgtagctagcgctagctgatgccaaaaa

If we use the function gesize(), indicating which column has the genetic sequences and which column has the name given to the sequence, we can retrieve the GC composition and length of the sequence:

> gesize(sequences$genseqs, sequences$columnames)
name    length    GC        sequence
1 seq1   112      59.82    GCGCGCGGGCATCGTAGCTGCTCGCGCTAGCTACGTCCGCTCTCGACTAGCTGACTGCGCTCAGCTATGCTACGATCGTACGATCGTGCTATGCTAGTGCATGCTAGCTAGC
2 seq2   114      51.75    CGATCGTAGCTACGTAGCTAGCTGATCGACTAGTGATCGCGTAGCTAGCTGCTGCTCGTCGTATGACTAGCTGATCGATCGATCGATCGTAGCTAGCTAGCTAGCTGATCGTAG
3 seq3   30       60       cgatcgcgatcgtactgctgtcggtggcta
4 seq4   83       49.4     cgatactcatatgcgtcgtaacgtctgctgtgtgtgctactatcgtagctacgtacgatcgatcgtgactcgatcgtagactg   
5 seq5   49       48.98    ACTCGTAGCGTTGGTCATcatcgtagctagcgctagctgatgccaaaaa 

meancat():

Calculates the mean of a numerical variable (n) according to certain category (m). For example, I have provided in the package a fake dataset of the number of dogs that different people have (I love dogs <3) called random_data:

> head(random_data, n=10)
   person  country n_dogs
1 person1    Spain      3
2 person2 Tanzania      2
3 person3      USA      1
4 person4    Spain      1
5 person5       UK      1
6 person6   Sweden      0
7 person7   Sweden      0
8 person8   Sweden      1
9 person9    Japan      2

If we use the function meancat(), we can observe how many dogs have people in average in every country:

> meancat(random_data$n_dogs, random_data$country)
         n      mean
Japan    1 2.0000000
Spain    2 2.0000000
Sweden   3 0.3333333
Tanzania 1 2.0000000
UK       1 1.0000000
USA      1 1.0000000

taxabu():

As a microbial ecologist, sometimes I need to estimate how many of my genomes are classified into different taxonomical levels (i.e., How many of my genomes are classified to the genus level? And to the class level?). To use this function, we need to provide a dataframe that should contain 8 columns, normally in the order as follows: mOTU, domain, phyla, class, order, family, genera, species.

Important to note: this function has been build using the taxonomy provided by GTDBtk (https://github.com/Ecogenomics/GTDBTk), and may not work with different formats.

For example, I have provided in the package a fake dataset of 8 bacteria called some_bacteria:

> head(some_bacteria, n=10)
# A tibble: 8 × 8
  mOTU     Domain      Phylum              Class                  Order               Family               Genus          Species
  <chr>    <chr>       <chr>               <chr>                  <chr>               <chr>                <chr>          <chr>  
1 mOTU_001 d__Bacteria p__Actinobacteriota c__Actinomycetia       o__Mycobacteriales  f__Mycobacteriaceae  g__Mycobacter… s__Myc…
2 mOTU_002 d__Bacteria p__Cyanobacteria    c__Cyanobacteriia      o__Cyanobacteriales f__Nostocaceae       g__Dolichospe… s__Dol…
3 mOTU_002 d__Bacteria p__Cyanobacteria    c__Cyanobacteriia      o__Cyanobacteriales f__Nostocaceae       g__Dolichospe… s__Dol…
4 mOTU_003 d__Bacteria p__Proteobacteria   c__Alphaproteobacteria o__Rhodobacterales  f__Rhodobacteraceae  g__Roseicyclus s__    
5 mOTU_004 d__Bacteria p__Cyanobacteria    c__Cyanobacteriia      o__PCC-6307         f__Cyanobiaceae      g__Synechococ… s__Syn…
6 mOTU_005 d__Bacteria p__Bacteroidota     c__Bacteroidia         o__Flavobacteriales f__Flavobacteriaceae g__Polaribact… s__Pol…
7 mOTU_006 d__Bacteria p__Proteobacteria   c__Alphaproteobacteria o__Rhodobacterales  f__                  g__            s__    
8 mOTU_007 d__Bacteria p__Cyanobacteria    c__Cyanobacteriia      o__PCC-6307         f__Cyanobiaceae      g__Vulcanococ… s__Vul…

To use taxabu() we just need to provide the dataframe using the function:

> taxabu(some_bacteria)
  Taxonomic_level Count
1            mOTU     8
2          Domain     8
3          Phylum     8
4           Class     8
5           Order     8
6          Family     7
7           Genus     7
8         Species     6
9           Total     8

As we can see, from a total of 8 genomes, 8 were classified to the order level, 7 to the genus level and 6 to the species level.

percencat():

However, if you want to estimate representation of different groups from a given category present on your dataset (let's say, you want to check how many Cyanobacteria are present in your dataset), your function is percencat().

> percencat(some_bacteria$Phylum)
                    Percentage (%) n
p__Actinobacteriota           12.5 1
p__Bacteroidota               12.5 1
p__Cyanobacteria                50 4
p__Proteobacteria               25 2
> percencat(some_bacteria$Genus)
                   Percentage (%) n
g__                          12.5 1
g__Dolichospermum              25 2
g__Mycobacterium             12.5 1
g__Polaribacter              12.5 1
g__Roseicyclus               12.5 1
g__Synechococcus_D           12.5 1
g__Vulcanococcus             12.5 1

which_envi():

This function calculates if a given categoric variable has a representation above or under 50%. Let's say that, given the dataset environments, we want to check how many of our genomes are aquatic and how many are terrestrial, but also check which sub-environments we find under these categories. First, let's observe the dataset:

> head(environments, n = 10)
# A tibble: 10 × 3
   species   environment1 environment2
   <chr>     <chr>        <chr>       
 1 species1  aquatic      marine      
 2 species2  aquatic      marine      
 3 species3  aquatic      marine      
 4 species4  aquatic      marine      
 5 species5  aquatic      marine      
 6 species6  aquatic      freshwater  
 7 species7  aquatic      freshwater  
 8 species8  aquatic      freshwater  
 9 species9  aquatic      freshwater  
10 species10 aquatic      freshwater  
...

To determine how many species we find on each sub-environment ($environment2), we will:

> which_envi(environments$environment1, environments$environment2)
         cat1             cat2  n n_cat1 proportion
1     aquatic       freshwater  6     11   Above50%
2     aquatic           marine  5     11   Under50%
3 terrestrial             clay  2     13   Under50%
4 terrestrial plant-associated  1     13   Under50%
5 terrestrial         volcanic 10     13   Above50%

Here, we observe that we have 11 species on aquatic environments (6 freshwater and 5 marine) and 13 terrestrial (2 clay, 1 plant-associated and 10 volcanic). This is indicated by n_cat1.

Note by a friend: when you indicate the environments, go from bigger to smaller environments (which environment includes which?).

Some useful resources:

Acknowledgements

Thanks Armando Pacheco Valenciana for your help testing the package. Thanks Sarahi L. Garcia for your useful advice.

About

An R package to help you PLAying with your genomic DAta.

Topics

Resources

License

Stars

1 star

Watchers

2 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages