The package plada aims to help you PLAying with your DAta (quite original name, huh?).
During my PhD I needed some specific functions in R, but I could not find a package that would perform them. Therefore, I decided to develope them. I used these functions to sort and analyze genomic information and metadata of microbial genomes assembled from metagenomes (MAGs), but I certainly think many people from other fields can find them useful!
At the moment, plada has 5 functions, but I may include more functions in the future: suggestions are appreciated.
Note that the package also includes 4 tables with data (sequences, some_bacteria,environments and random_data) to test the functions included here. But I'm sorry to tell you my friend, these tables were randomly generated and they are not real.
This package is currently only available through GitHub and can be downloaded using devtools.
> install.packages("devtools")
> devtools::install_github("alejandrorgijon/plada")
This function calculates the GC percentage of given sequences and calculates the length of them (aka number of bases).
For example, I have provided in the package a fake dataset of genetic sequences called sequences:
> head(sequences)
1 seq1 GCGCGCGGGCATCGTAGCTGCTCGCGCTAGCTACGTCCGCTCTCGACTAGCTGACTGCGCTCAGCTATGCTACGATCGTACGATCGTGCTATGCTAGTGCATGCTAGCTAGC
2 seq2 CGATCGTAGCTACGTAGCTAGCTGATCGACTAGTGATCGCGTAGCTAGCTGCTGCTCGTCGTATGACTAGCTGATCGATCGATCGATCGTAGCTAGCTAGCTAGCTGATCGTAG
3 seq3 cgatcgcgatcgtactgctgtcggtggcta
4 seq4 cgatactcatatgcgtcgtaacgtctgctgtgtgtgctactatcgtagctacgtacgatcgatcgtgactcgatcgtagactg
5 seq5 ACTCGTAGCGTTGGTCATcatcgtagctagcgctagctgatgccaaaaa
If we use the function gesize(), indicating which column has the genetic sequences and which column has the name given to the sequence, we can retrieve the GC composition and length of the sequence:
> gesize(sequences$genseqs, sequences$columnames)
name length GC sequence
1 seq1 112 59.82 GCGCGCGGGCATCGTAGCTGCTCGCGCTAGCTACGTCCGCTCTCGACTAGCTGACTGCGCTCAGCTATGCTACGATCGTACGATCGTGCTATGCTAGTGCATGCTAGCTAGC
2 seq2 114 51.75 CGATCGTAGCTACGTAGCTAGCTGATCGACTAGTGATCGCGTAGCTAGCTGCTGCTCGTCGTATGACTAGCTGATCGATCGATCGATCGTAGCTAGCTAGCTAGCTGATCGTAG
3 seq3 30 60 cgatcgcgatcgtactgctgtcggtggcta
4 seq4 83 49.4 cgatactcatatgcgtcgtaacgtctgctgtgtgtgctactatcgtagctacgtacgatcgatcgtgactcgatcgtagactg
5 seq5 49 48.98 ACTCGTAGCGTTGGTCATcatcgtagctagcgctagctgatgccaaaaa
Calculates the mean of a numerical variable (n) according to certain category (m).
For example, I have provided in the package a fake dataset of the number of dogs that different people have (I love dogs <3) called random_data:
> head(random_data, n=10)
person country n_dogs
1 person1 Spain 3
2 person2 Tanzania 2
3 person3 USA 1
4 person4 Spain 1
5 person5 UK 1
6 person6 Sweden 0
7 person7 Sweden 0
8 person8 Sweden 1
9 person9 Japan 2
If we use the function meancat(), we can observe how many dogs have people in average in every country:
> meancat(random_data$n_dogs, random_data$country)
n mean
Japan 1 2.0000000
Spain 2 2.0000000
Sweden 3 0.3333333
Tanzania 1 2.0000000
UK 1 1.0000000
USA 1 1.0000000
As a microbial ecologist, sometimes I need to estimate how many of my genomes are classified into different taxonomical levels (i.e., How many of my genomes are classified to the genus level? And to the class level?). To use this function, we need to provide a dataframe that should contain 8 columns, normally in the order as follows: mOTU, domain, phyla, class, order, family, genera, species.
Important to note: this function has been build using the taxonomy provided by GTDBtk (https://github.com/Ecogenomics/GTDBTk), and may not work with different formats.
For example, I have provided in the package a fake dataset of 8 bacteria called some_bacteria:
> head(some_bacteria, n=10)
# A tibble: 8 × 8
mOTU Domain Phylum Class Order Family Genus Species
<chr> <chr> <chr> <chr> <chr> <chr> <chr> <chr>
1 mOTU_001 d__Bacteria p__Actinobacteriota c__Actinomycetia o__Mycobacteriales f__Mycobacteriaceae g__Mycobacter… s__Myc…
2 mOTU_002 d__Bacteria p__Cyanobacteria c__Cyanobacteriia o__Cyanobacteriales f__Nostocaceae g__Dolichospe… s__Dol…
3 mOTU_002 d__Bacteria p__Cyanobacteria c__Cyanobacteriia o__Cyanobacteriales f__Nostocaceae g__Dolichospe… s__Dol…
4 mOTU_003 d__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Roseicyclus s__
5 mOTU_004 d__Bacteria p__Cyanobacteria c__Cyanobacteriia o__PCC-6307 f__Cyanobiaceae g__Synechococ… s__Syn…
6 mOTU_005 d__Bacteria p__Bacteroidota c__Bacteroidia o__Flavobacteriales f__Flavobacteriaceae g__Polaribact… s__Pol…
7 mOTU_006 d__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__ g__ s__
8 mOTU_007 d__Bacteria p__Cyanobacteria c__Cyanobacteriia o__PCC-6307 f__Cyanobiaceae g__Vulcanococ… s__Vul…
To use taxabu() we just need to provide the dataframe using the function:
> taxabu(some_bacteria)
Taxonomic_level Count
1 mOTU 8
2 Domain 8
3 Phylum 8
4 Class 8
5 Order 8
6 Family 7
7 Genus 7
8 Species 6
9 Total 8
As we can see, from a total of 8 genomes, 8 were classified to the order level, 7 to the genus level and 6 to the species level.
However, if you want to estimate representation of different groups from a given category present on your dataset (let's say, you want to check how many Cyanobacteria are present in your dataset), your function is percencat().
> percencat(some_bacteria$Phylum)
Percentage (%) n
p__Actinobacteriota 12.5 1
p__Bacteroidota 12.5 1
p__Cyanobacteria 50 4
p__Proteobacteria 25 2
> percencat(some_bacteria$Genus)
Percentage (%) n
g__ 12.5 1
g__Dolichospermum 25 2
g__Mycobacterium 12.5 1
g__Polaribacter 12.5 1
g__Roseicyclus 12.5 1
g__Synechococcus_D 12.5 1
g__Vulcanococcus 12.5 1
This function calculates if a given categoric variable has a representation above or under 50%.
Let's say that, given the dataset environments, we want to check how many of our genomes are aquatic and how many are terrestrial, but also check which sub-environments we find under these categories. First, let's observe the dataset:
> head(environments, n = 10)
# A tibble: 10 × 3
species environment1 environment2
<chr> <chr> <chr>
1 species1 aquatic marine
2 species2 aquatic marine
3 species3 aquatic marine
4 species4 aquatic marine
5 species5 aquatic marine
6 species6 aquatic freshwater
7 species7 aquatic freshwater
8 species8 aquatic freshwater
9 species9 aquatic freshwater
10 species10 aquatic freshwater
...
To determine how many species we find on each sub-environment ($environment2), we will:
> which_envi(environments$environment1, environments$environment2)
cat1 cat2 n n_cat1 proportion
1 aquatic freshwater 6 11 Above50%
2 aquatic marine 5 11 Under50%
3 terrestrial clay 2 13 Under50%
4 terrestrial plant-associated 1 13 Under50%
5 terrestrial volcanic 10 13 Above50%
Here, we observe that we have 11 species on aquatic environments (6 freshwater and 5 marine) and 13 terrestrial (2 clay, 1 plant-associated and 10 volcanic). This is indicated by n_cat1.
Note by a friend: when you indicate the environments, go from bigger to smaller environments (which environment includes which?).
- How to develop a R package? https://github.com/mvuorre/exampleRPackage
- Chaumeil PA, et al. 2022. GTDB-Tk v2: memory friendly classification with the Genome Taxonomy Database. Bioinformatics, btac672.
Thanks Armando Pacheco Valenciana for your help testing the package. Thanks Sarahi L. Garcia for your useful advice.